HRM Analysis Kit (EvaGreen)

Professional reagent for high resolution melting curve analysis.

HRM Analysis Kit (EvaGreen) combines the advantages of saturated dye EvaGreen and antibody modified polymerase, which is suitable for High Resolution Melting (HRM) analysis.  This kit can be used for analysis of known SNPs, screening of unknown SNPs, scanning of unknown mutant genes, methylation PCR analysis, etc.

Cat. No Packing Size
4992776 20 µl×125 rxn
4992873 20 µl×500 rxn

Product Detail

Product Tags

Features

■ High resolution: Adopt EvaGreen saturated dyes, which has high resolution of melting curve in saturated state and can distinguish the variation of single base.
■ High specificity: Use antibody modified hotstart DNA polymerase to reduce non-specific amplification and improve specificity.
■ High stability: The carefully optimize Buffer system increase the stability of melting curve and improve the reliability of results.
■ ROX correction: ROX dye is packaged separately, which is more flexible to use and have more accurate results.

Specification

Type: Antibody modified Taq DNA polymerase, EvaGreen.
Applications: Known SNP typing; Unknown SNP screening; Unknown mutant genes scanning; Methylation PCR analysis.

All the products can be customized for ODM/OEM. For details, please click Customized Service(ODM/OEM)

Experimental Example

Experimental Example

Genomic DNA was extracted from 100 μl of human blood sample using TIANamp Blood DNA Kit. 50 ng DNA was loaded for the real time PCR detection. According to NCBI SNP library, the known SNP of FEN1 gene (RS 174538) is selected and detected using Roche LightCycle480. The results are as follows:

The results show that HRM Analysis Kit is an ideal SNP locus analysis method with high repeatability of melting curve of the same genotype, clear resolution of different genotypes and no misjudgment.

SNP information: ……CGGAAGAACACGTCG[A/G]CAGGAGCAGGCGCCT…… (Allele Frequency: A=0.314, G=0.686)

Primer: For 108 bp fragment (FEN1_F: CCTCAACGCTCTCACCATTTTG; FEN1_R: GGCACTTCCTTTTCCGGTTGTG)


  • Previous:
  • Next:

  • product_certificate04 product_certificate01 product_certificate03 product_certificate02
    ×
    Write your message here and send it to us